Animal Free Cytokines refer to a series of cytokines without animal component. CUSABIO has provided many cytokines covered most of factors commonly used in cell culture.

Recombinant Human GM-CSF (CSB-AP002081HU)

Blue Curve CUSABIO Recombinant Human GM-CSF, ED₅₀=0.0175 ng/mL
Red Curve xx Company Recombinant Human GM-CSF, ED₅₀=0.0244 ng/mL

Recombinant Human TNF-alpha (CSB-AP005891HU)

Red Curve CUSABIO Recombinant Human TNF-alpha, ED₅₀=0.096 ng/mL
Green Curve xx Company Recombinant Human TNF-alpha, ED₅₀=0.26 ng/mL

High Purity

Recombinant Human GM-CSF (CSB-AP002081HU)

Recombinant Human IL-4 (CSB-AP005831HU)

Good Stability

Recombinant Human IL-4 (CSB-AP001691HU)

Part of CUSABIO Cytokines in Cell Culture

DC (Dendritic Cell)

CAR-T (Chimeric Antigen Receptor T Cell)

NSC (Neural Stem Cell)

HSC (Hematopoietic Stem Cell)

ESC (Embryonic Stem Cell)

Transmembrane protein series three: G protein-Coupled Receptor

Recombinant Human Atypical chemokine receptor 2(ACKR2) (CSB-CF004618HU)

Recombinant Human C-C chemokine receptor type 2(CCR2) (CSB-CF004841HU)

G protein-Coupled Receptor (GPCR) related proteins for your research

G protein-Coupled Receptor (GPCR) related antibodies for your research

G protein-Coupled Receptor (GPCR) related ELISA kits for your research

The Collection of Drug Target Proteins

Currently, targeted therapy is an effective method for cancer, which presents instinct advantages over chemical therapy. However, the appropriate selection of drug targets is the key to the success in cancer therapy.

Accurate identification of drug targets is a crucial part of any drug development program. So-called drug targets, we usually refer to a series of protein, and they are also known as drug target protein. The development of this drugs aims to discover properties of proteins that may be important in determining their suitability for pharmaceutical modulation.

The most common drug target proteins include three types, involving CD antigen, FC receptor and immune checkpoint.

Here, based on cancer databases and latest researches of cancers, we collect the hot targets of six cancer, including breast cancer, lung cancer, thyroid cancer, prostate cancer, stomach cancer and ovarian cancer. Additionally, we compile the latest development of drug targets in clinic application, and related signaling pathways. We hope these information will give you some inspiration in cancer therapy.

Cancer Drug Targets

Breast Cancer

Breast cancer is a cancer that develops in the tissues of breasts. In the United States, breast cancer is a cancer that is ubiquitous in women, second only to skin cancer. Actually, breast cancer can occur in both men and women, but it’s far more common in women.

Supported for breast cancer awareness prevalence and accumulating research funding has helped created advances in the diagnosis and treatment of breast cancer. Breast cancer survival rates have increased, and the number of deaths associated with this disease is steadily declining.

Additionally, we have compiled popular targets related to breast cancer based on cancer databases and recent research. These targets are shown as follows:

Lung Cancer

Breast cancer is a cancer that develops in the tissues of breasts. In the United States, breast cancer is a cancer that is ubiquitous in women, second only to skin cancer. Actually, breast cancer can occur in both men and women, but it’s far more common in women.

Supported for breast cancer awareness prevalence and accumulating research funding has helped created advances in the diagnosis and treatment of breast cancer. Breast cancer survival rates have increased, and the number of deaths associated with this disease is steadily declining.

Additionally, we have compiled popular targets related to breast cancer based on cancer databases and recent research. These targets are shown as follows:

Thyroid Cancer

As you know, thyroid is shaped like a small butterfly, and is usually found inside the lower front of your neck. It plays a critical role in regulating your metabolism. Moreover, it also releases hormones that direct many functions in your body, including the use of energy, heat production, and oxygen consumption. When it comes to pathological changes, the whole functions of your body are impacted.

Thyroid cancer is a typical cancer that develops from the tissues of the thyroid gland. It is a disease in which cells have undergone genetic mutation and grow abnormally. This disease also has the potential to spread to other parts of the body.

Currently, there is no clear reason why most people get thyroid cancer. Here, we have compiled popular targets related to thyroid cancer based on cancer databases and recent research. We hope there information would give you inspiration of thyroid cancer research. These targets are shown as follows:

Prostate Cancer

Prostate gland is a part of the male reproductive system that plays a role in semen production. Prostate cancer develops when the prostate cells undergo genetic changes. It is the most common malignancy among men (after skin cancer) and the cause of 1-2% of deaths in men. This disease can last several years or be lifelong. But, fortunately, it can often be treated successfully.

Here, we have compiled popular targets related to prostate cancer based on cancer databases and recent research. These targets are shown as follows:

Stomach Cancer

Stomach cancer, also called gastric cancer, begins when cancer cells form in the inner lining of your stomach. These cells can grow into a tumor. The disease usually grows slowly over many years. This cancer is one of the most common malignant tumors worldwide.

According to statistics from the latest data, 876,000 new cases of gastric cancer occur every year in the world, accounting for 9% of all new cancer cases, and ranking fourth after lung cancer, breast cancer and intestinal cancer.

As mentioned, this disease usually grows slowly over many years. In other words, the cancer may not cause any signs or symptoms or it may cause only nonspecific symptoms in its early stages because the tumor is small.

Additionally, we have compiled popular targets related to stomach cancer based on cancer databases and recent research. These targets are shown as follows:

Ovarian Cancer

Ovarian cancer is a type of cancer that forms in the ovaries. It causes by abnormal cell that have the ability to invade or spread to other sections of your body.
Generally, the female reproductive system contains two ovaries, one on each side of the uterus. The ovaries produce eggs (ova) as well as the hormones estrogen and progesterone.

Similar as stomach cancer, ovarian cancer often goes undetected until it has spread within the pelvis and abdomen. But this time is the late stage of ovarian cancer. At this stage, ovarian cancer is more difficult to treat. However, early-stage ovarian cancer is usually confined to the ovary and more likely to be treated successfully.

Here, we have compiled popular targets related to ovarian cancer based on cancer databases and recent research. These targets are shown as follows:

The latest Drug Research

Based on the latest drug research progression, we summarize the latest drug research of hot drug targets.

Tag/Loading Control Antibodies

CUSABIO Tag/ Loading Control Antibodies include highly specific monoclonal and polyclonal antibodies.

Tag antibodies

Tag antibodies can be used for the detection and purification of multiple proteins with the same tag. When certain target proteins cannot be immunoprecipitated without specific antibodies, an epitope can be used to label the protein, and then select a tag antibody for this epitope so that the immunoprecipitation can be continued. With the rapid development of proteomics, the use of recombinant proteins has greatly increased in recent years. Recombinant hybrids contain an affinity tag such as GST, Myc, His, etc., which can be used to assist the purification of the target protein, which has been widely used.

CUSABIO tag antibodies are purified by antigen affinity, and they can specifically bind to the corresponding tag proteins, then identify and purify the target proteins as well. Some of our popular tag antibodies are listed as below for your reference.

Loading control antibodies

Loading control antibodies are used to assesse western blotting efficiencies and compare the amounts of protein loaded in each well across a gel so that you can determine equal loading as well as the quality of the samples. It is important to use loading controls to determine protein expression and interpret Western blot results. Some common loading control antibodies include Beta Actin, GAPDH, Histone H3, Alpha Tubulin and Beta Tubulin, etc.

You cannot overemphasize the importance of loading control antibodies’quality. If the loading control is questionable, all of your results can be doubted. And CUSABIO is here to ease your worries. CUSABIO offers a wide selection of monoclonal loading control antibodies, including GAPDH, α-tubulin, and β-actin for several species. We also have some conjugated control antibodies, such as HRP- or biotin- conjugated control antibodies.

Here are the most hot-selling loading control antibodies.

The Features of CUSABIO Tag/Control Antibodies

Western Blot analysis of HA-Tag Monoclonal Antibody (CSB-MA000141M0m)

Western Blot analysis of E-Tag Monoclonal Antibody (CSB-MA000151M0m)

Western Blot analysis of GAPDH Monoclonal Antibody (CSB-MA000071M0m)

• Higher reliability: Small difference between batches

TUBA1A Monoclonal Antibody (CSB-MA754656A0m)

Lot Number: I0308A         Lot Number: I0424A

Flag Tag Monoclonal Antibody (CSB-MA000021M0m)

Lot Number: I0603A    Lot Number: I0419A

• Multiple Validations

HA-Tag Monoclonal Antibody (CSB-MA000141M0m)

Western Blot (WB)

Positive WB detected in: 3 different overexpression lysates with HA tagged
All lanes: HA-Tag antibody at 1:1000

Flow cytometry (FC)

Overlay histogram showing 293F transfected cells stained with CSB-MA000141M0m (red line) at 1:100.

Immunoprecipitation (IP)

Immunoprecipitating HA-Tag in 293F transfected whole cell lysate.
Lane 1: Mouse control IgG (1µg); Lane 2: CSB-MA000141M0m (5µg) + 293F transfected whole cell lysate (500µg); Lane 3: 293F transfected whole cell lysate (20µg)

Immunofluorescence (IF)

Immunofluorescence staining of 293F transfected cells with CSB-MA000141M0m at 1:100, counter-stained with DAPI.

GAPDH Monoclonal Antibody (CSB-MA000071M0m)

CUSABIO Tag/Loading Control Antibodies Catalog

Here is the catalog of all Tag/Loading Control Antibodies Catalog.

Useful resources

What is a Tag Antibody? What are Tag Antibodies used for?

A tag, or an epitope tag, is an antigenic sequence such as a protein or a polyhistidine that is determinant for the binding of a special antibody, which determines the specificity of an antigen. The tag is usually added to a protein of interest by using genetic engineering, forming a fusion protein which is detected by a corresponding antibody. Antibodies that specially recognize and bind these tag epitopes are called epitope Tag antibodies or Tag antibodies. When no specific antibodies are available in the detection of protein of interest, tag antibodiees are alternative and needed. Tag antibodies are used for protein isolation and purification, the tracking of protein expression and localization, protein-protein interactions. Some common experiments such as ELISA, western blotting, immunofluorescence and immunoprecipitation often use different tag antibodies.

What is a Loading Control Antibody? What are Loading Control Antibodies used for?

Control antibodies, as the name means, are series of internal control antibodies. They specific for a highly and constitutively expressed protein. Generally, control antibody can be divided into two groups, including isotype control antibodies and loading control antibodies. The best loading control antibody should be constantly and stably expressed in different tissues and under different physiological and pathological conditions. Housekeeping proteins are typically ideal candidates of loading control antibodies. Loading control antibodies are necessary to obtain accurate expression data in the western blotting. They are responsible for monitoring target proteins in the western blotting, confirming equal sample loading and gel-to-membrane transfer that causes more intense staining at the edge of the blot, and guarding against the “edge effect” in order to normalize results. Loading control antibodies can be also used to detect whether protein loading variation has occurred and may interpret observed variations in the target band(s).

So it is important to know How to select right Loading Control Antibodies for your WB.

Immune checkpoints are regulators of immune activation by regulating the antigen recognition of T cell receptor (TCR) in the process of immune response. They play a key role in maintaining immune homeostasis and preventing autoimmunity.

Based on the different role for immune activation, immune checkpoints are divided into two types: co-stimulatory immune checkpoints and co-inhibitory immune checkpoints.

Co-stimulatory immune checkpoints refer to one kind of immune checkpoint which can stimulate immune progress, such as CD28, ICOS, and CD137.

On the contract, co-inhibitory immune checkpoints play a negative role to immune progress. They inhibit immune progress, such as PD1, CTLA-4, and VISTA.

In cancer, immune checkpoint mechanisms are often activated to suppress the nascent anti-tumor immune response. This has led to the development of several checkpoint inhibitor antibody drugs that are currently being tested in clinical trials or have been approved for a number of cancers.

The Products of Immune Checkpoints

Recently, the R&D team from CUSABIO has developed various recombinant proteins of immune checkpoints for the researchers in this filed.

These recombinant immune checkpoint proteins cover multiple species and labels, and their biological activities are strictly analyzed and verified before shipping. In addition, we provide protein customization service. If you can’t find the protein you need, please contact us for custom service.

Biotinylated Proteins

Purity>92%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized human TNFRSF14 (CSB-MP842173HU) at 5 μg/ml can bind Biotinylated human TNFSF14, the EC50 is 1.773-3.707 ng/ml.

Recombinant HumanTNFSF14, partial, Biotinylated (Active) (CSB-MP023991HUj7-B)

Purity>92%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized Anti-CD44 Mouse Monoclonal Antibody (CSB-MA004938A0m) at 2 μg/ml can bind Biotinylated human CD44, the EC50 is 2.865-5.099 ng/ml.

Recombinant Human GHR, partial, Biotinylated (Active) (CSB-MP009411HUj1-B)

Purity>95%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized human GH1 (CSB-MP009407HU) at 2 μg/ml can bind Biotinylated human GHR, the EC50 is 2.067-3.208 ng/ml.

Recombinant Human ULBP1, Biotinylated (Active) (CSB-MP887177HUj1-B)

Purity>95%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized KLRK1 (CSB-MP012474HU1) at 10 μg/ml can bind human Biotinylated ULBP1, the EC50 is 4.254-7.295 ng/ml.

Recombinant Human TNFSF13B, partial (Active) (CSB-MP897523HU1-B)

Purity>92%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized human BCMA (CSB-MP023974HU1) at 5 μg/ml can bind Biotinylated human TNFSF13B, the EC50 is 0.1752-0.3657 ng/ml.

All of Biotinylated Proteins

Assay kits are widely used in many research areas including life science research, drug discovery, environmental monitoring, etc. They have become an indispensable tool in experiments. The existence of assay kits allows the experimenter to get rid of the heavy reagent preparation and optimization process. Because of that, researchers get more time to do further study.

CUSABIO offers thousands of assay kits for researchers worldwide since 2007. These kits have most advantages of kits on the market, such as easy to use, time-efficient, wide application, etc. Moreover, CUSABIO provides 100% Risk-free Performance Guarantee so that the researchers don’t need to worry about the product quality.

ELISA Kits

Exosome Isolation Kits

ELISA Kits

ELISA kits are a quick, convenient, and accurate research tool for the detection and quantitation of targets of interest in cultures and samples. Because of their exceptional advantage, ELISA kits are used in many important research areas, including cancer, cardiovascular, cell biology, epigenetics, metabolism, immunology, neuroscience, signal transduction, etc.

CUSABIO has 13+ years of experience in manufacturing ELISA kits and has formed a sound platform for the development of ELISA kits.

As a trustworthy ELISA kit supplier, we offer 4000+ ELISA test kits mainly in sandwich ELISA format, including 3000 targets, covering species of human, mouse, rat, bovine, etc.

As your partner in biological research, we completely understand the hardships of your work, and we try our best support to your research by optimizing every detail of our products and service.

CUSABIO has the strictest quality control system to ensure every ELISA kit has no quality issues so that you can get accurate data in your experiments. And CUSABIO technical team will be on your back all the time.

Product Features

Ready-to-use

Each ELISA kit consists of a coated plate and a ready-to-use solution. No special handling required. Simple operation.

Multiple Species

CUSABIO ELISA kits cover more than 30 species with broad research areas, including human, mouse, rat, bovine, rabbit, pig, sheep, goat, monkey, etc.

High Sensitivity

We randomly compared our ELISA kits sensitivity with other suppliers’.

Multiple Biological Samples

CUSABIO ELISA kits are validated in multiple biological samples:
serum, plasma, body fluids, such as urine, cell culture supernatant, cell/ tissue lysate, tear, breast milk, saliva, etc.

Cited in more than 7000 References

CUSABIO ELSA kits are cited in more and more publications in well-known magazines such as Nature, PLOS One, JASN, Bio-Factors, Scientific Reports, APS and so on.

Useful Resources

What is ELISA?

ELISA, short for enzyme-linked immunosorbent assay, is a method to detect the presence of a ligand, which usually is a protein, in a liquid sample using antibodies directed against the protein to be measured.

Compared with other immunoassay methods, ELISA is featured with higher sensitivity, specificity and throughput. Moreover, it is easy to perform. These advantages make ELISA be a very popular choice for researchers from various areas.

How does an ELISA Kit Work? What is the Typical ELISA Workflow?

Firstly, the antigens of interest are immobilized on the microplate by overnight incubation. This step forms antigen-coated wells.

Secondly, add the enzyme-labeled antibodies to the wells. Sometimes the unconjugated antibodies are added before the addition of the enzyme-labeled antibodies according to the experiment requirement. The antigens are directly captured by the enzyme-labeled primary antibodies or indirectly captured via the enzyme-labeled secondary antibodies that have been attached to the unconjugated antibodies on the microplate.

Thirdly, specific biotinylated detection antibodies are added to the wells to enable detection of the captured antibodies. The addition of the substrate solution is then added to each well. The color reaction is presented after incubation of the plated at 37 degrees celsius for 5 minutes.

Here is the typical ELISA workflow.

Exosome Isolation Kits

Product Features

CD9 (CSB-MA004969A0m )

ENO1 (CSB-MA007670A0m )

1. Exosomes extracted from plasma
2. Exosomes extracted from serum
3. Exosomes extracted from urine
4. Exosomes extracted from Hela cells
5. Exosomes extracted from latex
6. Exosomes extracted from latex

Exosomes extracted from Hela cells

Exosomes extracted from latex

Exosomes extracted from pichia pastoris

Exosomes extracted from serum

Exosomes extracted from saliva

Exosomes extracted from kluyveromyces lactis

Exosomes extracted from plasma

Exosomes extracted from urine

Can be used in the supernatant of a variety of cells

CUSABIO Exosome Isolation Kits are available to isolate exosomes from the supernatant of various cells, such as A375, HEPG2, PC-3, Hela, U87, MG63, etc.

High Purity

The exosomes extracted by CUSABIO kits are complete in shape, spherical or dish-shaped, with uniform particles. Vesicles are structurally intact. The following are a part of the results.

High Yield

There are up to 3 x 10¹¹ particles of purified exosomes per millilitre.

CUSABIO (CSB-EI0102, CSB-EI0110)
Particle size: 79.19 nm
Concentration: 3.08*10¹¹ particles /mL

High Efficiency

The exosomes extracted by CUSABIO Exosome Isolation Kit are superior to the other three well-known brand kits and comparable to ultracentrifugation.

		CSB-EI0102(2T), CSB-EI0110(10T) Company A Company B Company C Ultracentrifugation Hela Cell Lysate
GAPDH (CSB-MA000071M0m)	CD9 (CSB-MA004969A0m)
ENO1 (CSB-MA007670A0m)	PKM (CSB-MA018072A0m)

Simple to use

No ultracentrifugation or phenol/chloroform step required. No equipment requirement. Just follow our protocol, you will get the exosomes soon.

Competitive prices and excellent technical support

Prices of CUSABIO exosome isolation kits are very competitive. We have an efficient production and management system so that we can manufacture premium reagents at less cost and our customers can get better quotes.

What’s more, CUSABIO has a powerful technical support team and complete after-sales service here to meet the needs of every purchase so that you have no worry and save time & energy for your research.

Useful Resources

More Information about Exosomes

Why Study Exosomes?

Extracellular vesicles (EVs) are small membrane vesicles, composed of a lipid bilayer with inserted transmembrane proteins, enclosing cytosolic components (protein, mRNA, and miRNA) derived from the EV-producing cells.

These EVs such as exosomes have been found in biofluids, including blood, saliva, urine, cerebrospinal fluid (CSF) and latex, act as messengers of intercellular communication networks. EVs carry lipids, proteins, and RNAs derived from their producing cells, and have potential as biomarkers specific to cell types and even cell states.

How Do You Get Exosomes?

However, conventional methods (such as ultracentrifugation or polymeric precipitation) for isolating EVs have disadvantages regarding purity and feasibility.

CUSABIO offers a wide range of diagnostic kits for food safety & drug residues in feed and food. CUSABIO develops effective solutions for the analysis of food and feed samples. The CUSABIO elisa kit are especially designed to meet high quality demands in feed and food testing focusing mainly on chemical contaminants comprising on natural and artificial contaminants. Our main lines are antibiotics, mycotoxins and hormones testing solutions.

CUSABIO Recombinant Protein Expression Service
12 years’experience, 15000+ orders completed, 99.1% success rate

• Risk-free: Do not charge by steps. No protein, No charge
• Competitive price
• 39 kinds of tags meeting different demands
• Secondary AKTA-SEC purification to ensure high purity
• Ability to achieve large-scale protein production (10 mg, 50 mg, 100 mg, 200 mg available)
• Post-purification services available: Desalting, aliquot, endotoxin removal, aseptic process and lyophilization

Service process:

Final Deliverables:

{GGGTTA}₄₂

{GCTTCCCCCTG}₁₀

{CAC}₈₂

{GGTCCTCCGCCTCCTCCACCTC}₆

We generally use PCR technology to do directional or random mutations for mutation sites on the basis of guaranteeing fidelity in original sequence, types including bases addition, deletion, mutations etc. It is the common research means of genetic evolution, protein engineering, enzyme engineering etc.

Modified Oligo Synthesis :

Common modification forms of primer include phosphorylation, biotin, high and new, internal amino modification, 5 ‘ amino modification, 3 ‘ amino modified, etc. They can be used for all kinds of nonradioactive immunity analysis, hybridization reaction.

Cusabio has powerful primer synthesis ability, we can quickly synthesize high quality common primers for you, and we can also provide many kinds modify group of modified primer synthesis service. Such as:

RNA Synthesis :

Chemical synthesized RNA as an important research tool, is widely used in the research and application of gene function analysis, new types of treatment strategies development etc.

Cusabio is equipped with various kinds of full-automatic synthesizers, advanced purification equipment, and has rich experience in RNA synthesis, has a perfected set of RNA synthesis and purification technology, can provide RNA synthesis products with high quality, including: single-stranded RNA, double-stranded RNA, modified/tagged RNA, siRNA, miRNA, mimics, etc.

In order to ensure the high quality of RNA oligo, Cusabio synthesizes RNA through MALDI – TOF mass spectrometry identification (matrix – assisted laser desorption/ionization time – of – light) with strict QC standards, and analyzes the purity of RNA product by HPLC.

CUSABIO Features of Phage Display Human Native Antibody Library

CUSABIO Service Process of Antibody Humanization

CUSABIO Service Process of Affinity Maturation

Choice of 80,000 possible targets, or provide the antigen/protein name, uniport reference or immunogen sequence.

Service includes everything from gene synthesis to purified antibody

Minimum order of either10mg protein A/G purified antibody or 1mg of antigen affinity purified antibody

Deliverables

• Purified recombinant rabbit polyclonal antibody to specified target with a guaranteed titer of over 1:64,000 confirmed by ELISA. Final concentration to be provided at the end of the process.
• Western blot data for the immunogen protein (Not applicable for synthetic peptide nor endogenous samples)
• Immunogen sequencing report
• 200ug of the immunogen protein
• Pre-immune serum
• Optional Free HRP, FITC, or Biotin conjugation
• Control tag secondary antibodies

Thousands of made-to-order proteins from uncommon species including Saccharomyces cerevisiae, Arabidopsis thaliana, Rattus norvegicus, Bos taurus and others.

With a choice of

• Sizes 20ug, 100ug or 1mg
• Expression systems including, bacteria, yeast, baculovirus or mammal.
• Tags
• Buffers (request you own)
• Expression regions (fully customizable)